BEHR MARQUEE® Interior Matte No.1450

Average Rating:

BEHR MARQUEE® Interior Paints are Rated by Consumer Reports

Consumer Reports does not endorse products or services.

BEHR MARQUEE Interior Matte Paint is our most advanced interior paint & primer that delivers high-performance one-coat hide guaranteed* with every color in the exclusive MARQUEE Interior One-Coat Color Collection. This antimicrobial-mildew resistant finish has excellent durability, washability and stain resistance.

A matte sheen has a flat, low-reflective finish that's easy to clean, touches up well and will also hide minor surface imperfections.
Best for use in
Use on properly prepared interior walls and ceilings of new or previously painted drywall, plaster, masonry, wood, and metal.
250-400 Sq Ft per Gallon depending on the application method and substrate porosity. It does not include the loss of material from spraying.

Read important application instructions to ensure optimum paint performance.

Technical Data Sheets

Download TDS

Product Certifications & Declarations

Available in Over 2,500 Colors

Find the perfect color for all your projects

Explore Colors
Home Depot Xtra membership logo

Join The Home Depot® Pro Xtra Loyalty Program

Members get exclusive, money-saving offers and special coupons for the products they use most.

  • Save up to 20% on paints, stains, and primers
  • Free direct-to-job site paint delivery
  • Free Factory tinting & color matching
  • Dedicated field support
  • Phone-in orders
  • Lifetime of color history by job
Join Now

Product Usage

Clock icon

1 HR Dry Time
2 HR Recoat Time

Paint coverage icon.

Up to 400 Sq. Ft.
Coverage per Gallon

Thermometer Icon

from Freezing

Soap and water cleaning a paint brush icon

Soap & Water

Where to UseBlank space if empty.

Properly prepared coated interior surfaces. Ideal for every room.

Usage SummaryBlank space if empty.
Preparation & PrimeBlank space if empty.

All Surfaces:

  • Properly prepare and clean all surfaces.
  • Remove loose paint, wash off dirt and grease with detergent, rinse and allow to dry. Remove mildew stains with a mildew stain remover.
  • Scuff sand glossy surfaces and repair imperfections.
  • Remove all dust with a damp cloth, allow to dry.
  • Allow new stucco, plaster and masonry to cure for 30 days before painting.
  • Use BEHR MARQUEE paint as a primer for uncoated, porous or repaired interior surfaces, including woods that contain tannins (two primer coats required for redwood and cedar).

Stained Surfaces:

  • Lock in stains with BEHR MARQUEE as a spot primer.
  • For heavy stains, test for stain bleed-through by applying BEHR MARQUEE to a small section.
  • If the stain bleeds through, spot prime with another coat to the stained area and test again before topcoating.
  • If bleeding continues, a longer dry time is needed before topcoating.
ApplicationBlank space if empty.
  • Apply when air and surface temperatures are between 50-90°F (10-32°C).
  • Stir paint occasionally. Intermix containers of same product to ensure color and sheen uniformity.
  • Use a high quality 3/8-1/2" nap roller cover, nylon/polyester brush or an airless sprayer (.015 - .019" spray tip, 60 mesh filter).
  • Do not thin if using a roller or brush; however, if using a sprayer and thinning is required, thin with water at a rate of no more than 1/2 pint per gallon.
  • Fully saturate roller for best coverage.
  • Untinted ULTRA PURE WHITE® and colors outside of the MARQUEE Interior One-Coat Color Collection may require more than one coat to achieve complete hide and a uniform finish.
  • Darker colors may require additional dry time between coats. Cooler temperatures or higher humidity may prolong drying time.
  • After 4 weeks, cured paint film may be cleaned with a mild, non-abrasive liquid detergent.
  • Dry paint film is mildew resistant.
  • Do not use on floors.
DisposalBlank space if empty.
  • For disposal of empty containers, unused paint and soiled rags, contact your household refuse collection service.

Read Application Instructions


Behr Process Corporation warrants to you, the original residential consumer purchaser, the performance of this product as described on this label for so long as you reside in your home. THIS WARRANTY IS NOT VALID WHEN THE PRODUCT IS NOT PROPERLY APPLIED TO A PROPERLY PREPARED SURFACE OR CARED FOR IN ACCORDANCE WITH THE LABEL DIRECTIONS. This warranty is not transferable. If this product is found not to perform as specified on the label during the warranty period, Behr Process Corporation will, at its option and upon presentation of proof-of-purchase (the original receipt), either furnish an equivalent amount of new product or refund the original purchase price of this product to you. This warranty excludes (1) labor and costs of labor for the application or removal of any product, and (2) any incidental or consequential damages, whether based on breach of express or implied warranty, negligence, strict liability or any other legal theory. Some states do not allow the exclusion or limitation of incidental or consequential damages, so the above limitation or exclusion may not apply to you. This warranty gives you specific legal rights and you may also have other rights, which vary from state to state. Note to residents of the State of New Jersey:  The provisions of this warranty, including its limitations, are intended to apply to the fullest extent permitted by the laws of the State of New Jersey. To obtain warranty service, call 1-800-854-0133. Behr Process Corporation reserves the right to inspect any and all application of the product prior to processing your claim made under this warranty.

Read Warranty Information

BEHR MARQUEE ® Interior Matte No.1450 is rated 4.3 out of 5 by 18.
Rated 4 out of 5 by from Wonderful Paint. one coat hide for sure a;kdf'alkfd;sakfd;laskjf. a;lkdjf;kajfd;la j. lkjfkdjfoewierfklskdfjaslfj
Date published: 2019-08-28
Rated 5 out of 5 by from QA Analyst US - Test for story STRY0117437 - BV to create a separate Deployment Zone for Behr Canada English - Code change required on our end
Date published: 2019-07-16
Rated 1 out of 5 by from #BVSFTEST review 18-02-2019 #BVSFTEST review 18-02-2019 #BVSFTEST review 18-02-2019
Date published: 2019-02-18
Rated 5 out of 5 by from This is a test. This is a test. This is a test. Th This is a test. This is a test. This is a test. This is a test. This is a test. This is a test. This is a test. This is a test. This is a test. This is a test. This is a test. This is a test. This is a test. This is a test. This is a test. This is a test. This is a test. This is a test.
Date published: 2018-11-02
Rated 5 out of 5 by from test testtesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttesttest
Date published: 2017-11-09
Rated 5 out of 5 by from High Rating High RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh RatingHigh Rating
Date published: 2017-06-02
Rated 1 out of 5 by from This is a test review This is a test review for psl regression testing and demo
Date published: 2017-05-23
Rated 2 out of 5 by from test test test test test test test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test testtest test test test
Date published: 2017-05-18
Rated 5 out of 5 by from Best Awesome Fantastic test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test test
Date published: 2017-05-11
Rated 5 out of 5 by from Best in the West Love, love, love Behr Paint, it is the Best in the West!!
Date published: 2017-02-28
Rated 5 out of 5 by from QA Test This is a test xyxyxyxyxyxyxyxyxyxyxyxyxyxyxyxyxyxyxy
Date published: 2016-11-02
Rated 5 out of 5 by from test testtestteststetttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt
Date published: 2016-10-28
Rated 5 out of 5 by from Test Reviewer 1234 This is a test review This is a test review This is a test review This is a test review
Date published: 2016-03-16
Rated 5 out of 5 by from QA Testing This is a test BEHR MARQUEE Stain-Blocking Paint & Primer Interior Matte is our most advanced interior paint – delivering high-performance one-coat coverage with every color in the exclusive MARQUEE Interior One-Coat Color Collection. Expressing yourself with exactly the colors you want has never been easier. The MARQUEE Interior One-Coat Color Collection offers an extensive palette of colors in both classic and contemporary hues. It’s the combination of MARQUEE Interior
Date published: 2015-03-18
Rated 5 out of 5 by from test testtesttesttesttesttesttesttesttesttesttesttesttesttesttesttest
Date published: 2015-03-10
Rated 5 out of 5 by from catcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatca catcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcat
Date published: 2015-03-04
Rated 5 out of 5 by from This is a TEST-Best Purchase Ever This is a Test from QA-2-25-2015-California BEHR MARQUEE Stain-Blocking Paint & Primer Interior Matte is our most advanced interior paint – delivering high-performance one-coat coverage with every color in the exclusive MARQUEE Interior One-Coat Color Collection. Expressing yourself with exactly the colors you want has never been easier.
Date published: 2015-02-26
  • y_2021, m_1, d_25, h_14
  • bvseo_bulk, prod_bvrr, vn_bulk_3.0.13
  • cp_2, bvpage2n
  • co_hasreviews, tv_0, tr_18
  • loc_en_US, sid_1010101001450-I-Pro, stg, sort_[SortEntry(order=FEATURED, direction=DESCENDING), SortEntry(order=SUBMISSION_TIME, direction=DESCENDING)]
  • clientName_behr
  • bvseo_sdk, java_sdk, bvseo-4.0.0
  • CLOUD, getContent, 124ms

Ready to get started?


Contact a BEHR PRO® rep

Your reputation depends on your ability to do the job right. BEHR can help.

Find a rep

Save up to 20% OFF
BEHR® Paints, Stains & Primers.

Home Depot Pro XTRA royaly program
Technical services

1-800-854-0133 ext. 2

Mon - Fri, 6am-5pm PST
Sat, 7am-3:30pm PST
Sun, Closed

Never miss out on the latest deals and news from behr.